The topic of this article may not meet Wikipedia's general notability guideline. (November 2017) |
The Mesodinium nuclear code (translation table 29) is a genetic code used by the nuclear genome of the ciliates Mesodinium and Myrionecta.[1]
The code (29)
editAAs = FFLLSSSSYYYYCC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = --------------*--------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).
Differences from the standard code
edit| DNA codons | RNA codons | This code (29) | Standard code (1) | |
|---|---|---|---|---|
TAA |
UAA |
Tyr (Y) |
Ter (*)
| |
TAG |
UAG |
Tyr (Y) |
Ter (*)
|
See also
edit- List of all genetic codes: translation tables 1 to 16, and 21 to 31.
- The genetic codes database.
References
editThis article incorporates text from the United States National Library of Medicine, which is in the public domain. [2]
- ^ Heaphy, Stephen M.; Mariotti, Marco; Gladyshev, Vadim N.; Atkins, John F.; Baranov, Pavel V. (2016-11-01). "Novel Ciliate Genetic Code Variants Including the Reassignment of All Three Stop Codons to Sense Codons in Condylostoma magnum". Molecular Biology and Evolution. 33 (11): 2885–2889. doi:10.1093/molbev/msw166. ISSN 0737-4038. PMC 5062323. PMID 27501944.
- ^ Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 18 November 2016.