Talk:LacUV5

Pribnow 1975

Latest comment: 5 years ago1 comment1 person in discussion

The described promoters, A2 and A3, look nothing like LacUV5. I have removed this part from the article:

The promoter is initially found in T7 phage driving gene 1, which codes for T7 RNA polymerase. Two versions were described, named A2 and A3; A3 allows for read-through. The alignment in the original paper is retained.^[1]
A2 GAAGTAACATGCAGTAAGATACAAATCGCTAGGTAACACTAGCAG^[2] [bind?] A3 GAAGTAAACACGGTACGATGTACCACATGAAACGACAGTGAGTCACCACACTGA^[3]

^ Pribnow, D (1975). "Bacteriophage T7 Early Promoters: Nucleotide Sequences of Two RNA Polymerase Binding Sites". Journal of Molecular Biology. 99 (3): 419–443. doi:10.1016/S0022-2836(75)80136-7.

^ "Enterobacteria phage T7 strain T7Del1revsplitRNAP, Promoter A2". GenBank. Retrieved 21 April 2019.

^ "Enterobacteria phage T7 strain T7Del1revsplitRNAP, Promoter A3". GenBank. Retrieved 21 April 2019.

--Artoria 2e5 🌉 21:08, 21 April 2019 (UTC)Reply

Add topic

[pribn1975-1] Pribnow, D (1975). "Bacteriophage T7 Early Promoters: Nucleotide Sequences of Two RNA Polymerase Binding Sites". Journal of Molecular Biology. 99 (3): 419–443. doi:10.1016/S0022-2836(75)80136-7.

[2] "Enterobacteria phage T7 strain T7Del1revsplitRNAP, Promoter A2". GenBank. Retrieved 21 April 2019.

[3] "Enterobacteria phage T7 strain T7Del1revsplitRNAP, Promoter A3". GenBank. Retrieved 21 April 2019.

[1]

[2]

[3]