Talk:Homologous recombination

Introduction

The introduction does not actually say what HR is. ie. no summary explanation. —Preceding unsigned comment added by 99.234.154.88 (talk) 19:33, 20 April 2009 (UTC)

Could you be more specific on how you think the introduction could be improved? The first sentence notes that HR "is a type of genetic recombination in which genetic material is exchanged between two similar or identical strands of DNA", which is a high-level definition of what HR actually is. Thanks, Emw2012 (talk) 19:43, 20 April 2009 (UTC)

Reference to Add

I do not know how to add a reference, but would add "Molecular Biology of the Gene, Fifth Edition" by James D. Watson, et al. I started to add it, but it seemed like a mess, so I left it out.

I would add this article also: http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=18022364

It discusses how RecD appears only to be inactivated, not lost from the complex. It has some important information for the RecBCD articles, as well. —Preceding unsigned comment added by RegiG (talk • contribs) 02:01, 1 July 2008 (UTC)

Suggestions

Hello, I have a few suggestions to help improve this article. First, though, big thanks to Emw2012 for all his recent work on this article. I've been watching these edits and the improvement is really remarkable! Here are my suggestions:

• More detailed information on the roles of the eukaryotic recombination proteins, similar to the discussion of the bacterial proteins in the article. A good place to start could be the biochemical roles of the Rad52 epistasis group in yeast, and then move on to mammalian proteins.
• The mechanism of 5' end resection has recently been elucidated and should be in this article. Here is a good review. I think this would also be a good place to talk about regulation of the choice between recombination and non-homologous end joining for double-strand break repair.
• A section on the single-strand annealing pathway should be added.
• Holliday junction resolvases should be discussed, in particular the recent series of papers on Slx1-Slx4 that came out in Cell and Molecular Cell in July.

I will help with some of this if I get a chance. Amazinglarry (talk) 02:29, 24 August 2009 (UTC)

• Thanks for your suggestions, and your compliment. I agree that the 'In eukaryotes' section would benefit from giving more attention to specific proteins and their role. I've also had an explanation of post-synapsis steps of bacterial and eukaryotic recombination on the backburner; I will give that attention along with your other suggestions. I'm very appreciative to have someone with significant experience in DNA repair research giving feedback on the article. Emw2012 (talk) 04:14, 24 August 2009 (UTC)

Context of ocurrence

"The World of the Cell", introductory book on Cell biology, ISBN 978-0-321-55418-5, Pearson/BenjaminCummings, mentions on page 627 five different situations in which hom. rec. occurs: 1) Two different phages infect the same bacterium 2) Uptake of raw DNA in bacteria (transformation) 3) Systematic transfer of genetic material (plasmids) between bacteria (conjugation) 4) Prophase I 5) Transfer of bacterial genes between bacteria by incorporation in virus (phage) (transduction). The present article mentions meiosis and mitosis. This seems rather incomplete. --Ettrig (talk) 07:19, 7 September 2009 (UTC)

Transformation is pretty much covered in the gene targeting section, and the other 3 (conjugation, transduction, 2 phages) could be added in a couple sentences in the "In bacteria" section. They're probably worth a mention for historical reference, but maybe try to keep it short since phage is not used as a model system for genetics much any more. I don't think many people are going to come to this article looking for phage stuff. Amazinglarry (talk) 12:15, 7 September 2009 (UTC)

Outdated research. Interesting. The book is copyrighted 2009. But aren't transfer by virus and recombination of viruses important for evolution and humankind, e.g. in creating new influenzae strains? --Ettrig (talk) 12:52, 7 September 2009 (UTC)

Regarding transformation, conjugation etc., I've tried to address these with the "Horizontal gene transfer" subsection of "In bacteria". I'll augment the section and mentioned the particular types of HGT since the target audience may not take note of HR's role in them otherwise. I think it would also be good to at least briefly discuss the relationship between HR and viral reassortment, which you've alluded to. Emw2012 (talk) 13:45, 7 September 2009 (UTC)

But when reading reassortment I get the impression that this is not HR, so there is no relation? --Ettrig (talk) 14:15, 7 September 2009 (UTC)

You're right -- I had a misunderstanding about reassortment that was cleared up by the explanation here. Homologous recombination in viruses seems to be the subject of at least a few papers (e.g. this paper and several articles citing it). I agree that viral HR should be discussed in the article. Emw2012 (talk) 17:20, 10 September 2009 (UTC)

Model bacteria

The article currently says "Studies in several model bacteria ...". Is "model" valuable here? I think the normal use of "model" in contexts like these is used to signal that one really is interested in studying a mechanism in the human body, but studying the corresponding mechanism in another organism instead, in the hope that the mechanism in the other organism is sufficiently similar to the human one. This article is not specifically about human HR. --Ettrig (talk) 16:13, 10 September 2009 (UTC)

I find that model is used extensively in the article. I think this is because medical research is such a large part of melecular biology research. Possibly the meaning of this expression has changed in the modern context, from used to provide "insight into the workings of other organisms", as Model organism says, to used to provide insight into a particular mechanism, subsystem etc. But for the time being we should stick to the Wikipedia description of the concept. --Ettrig (talk) 16:23, 10 September 2009 (UTC)

While the article isn't exclusively about human HR, I don't think the use of "model" throughout is unwarranted. Research in bacterial HR is often done with the assumption that findings there will at least somewhat transfer to understanding of human HR -- this is evidenced by various societies for eliminating cancer funding research in bacterial HR, for example. Since they can reveal how many aspects of HR mechanisms work in other organisms, including us, bacteria can indeed be model organisms. With regard to a distinction between "workings" and "mechanisms", I don't see how there's much of a difference, if any. Consider the list of bacteria in the article on model organisms. It is precisely because they reveal information about low-level biological phenomena (e.g., HR) applicable to other organisms that those bacteria are considered model organisms. The listing for E. coli contains more or less the wording you removed. Looking at RNAi, another featured article on a mechanism in molecular biology, I don't see how this article differs in appending "model" to various organisms. Emw2012 (talk) 17:04, 10 September 2009 (UTC)

I think you're reading a little too much into the phrase, Ettrig. Pretty much any organism used frequently in research is called a "model organism" or referred to as a "model system." It's just a phrase, it's not meant to imply that studying a non-human organism for reasons other than gaining insight into human biology is somehow unimportant. Amazinglarry (talk) 00:36, 11 September 2009 (UTC)

I agree, if for example we are studying HR in E. coli, then it is a model organism for (from least to greatest specificity) HR in general, HR in bacteria, HR in gram negative bacteria, HR in Enterobacteriaceae, and the strain your studying is a model for other E. coli strains. Gobbits (talk) 06:56, 18 May 2015 (UTC)

Bacterial Transformation

I think that the section needs to be significantly streamlined, it has a lot of unnecessary information, and it doesn't have any sources for half the things it says. Gobbits (talk) 07:02, 18 May 2015 (UTC)

Protein engineering

For starters, this is a nice article! In the Protein Engineering section, we might consider adding links to DNA shuffling, RACHITT and other similar articles. However, those two articles I mentioned are in need of attention. Pdcook (talk) 17:03, 18 September 2009 (UTC)

Editorial

the intro says These new combinations of DNA produce genetic variation. This is grammatically wrong. The process of recombination produces genetic variation. The combinations themselves ARE the genetic variation. The article is so well formulated in general, that I dare not make the corrections myself. In my opinion it is overdue for the GA stamp. --Ettrig (talk) 16:00, 21 September 2009 (UTC)

• Good point. I've changed 'produce' to 'represent', and tweaked the rest of the sentence for flow. Emw2012 (talk) 17:28, 21 September 2009 (UTC)

Comments by Cryptic C62

Here are some comments on the article's prose:

Resolved comments

"It is most widely used to accurately repair harmful breaks that occur on both strands of DNA, known as double-strand breaks." I would advise against the use of the word "used" here, as it implies that it is a tool that can be used at will rather than a natural process which we have no control over. Readers who are unfamiliar with genetics and genetic engineering may be mislead to believe that this article relates to the latter rather than the former. Instead, how about "It often occurs as a means of accurately repairing harmful breaks that occur on both strands of DNA, known as double-strand breaks." ? The suggested wording seems too passive to me, and uses 'occur' twice in the same sentence. While higher organisms don't have direct control over it, cells do: HR is very tightly regulated. I think your concern could be addressed more simply by changing the phrase to 'most widely used by cells to'. The featured article on DNA invokes 'use' similarly in the lead without issue, as do the featured articles RNAi, Virus, and Bacteria in their respective bodies. Emw (talk) 01:37, 25 June 2010 (UTC) "There are several different types of homologous recombination, and they have some similar steps." This sentence is not helpful in introducing the material in the paragraph that follows it, nor is it written in a particularly encyclopedic tone. I'm not even sure what exactly this sentence is trying to convey. Are you trying to make it clear that homologous recombination is similar throughout all organisms? Or that it is widely different throughout various organisms, but certain steps are the same? Or that within a single organism multiple methods for homologous recombination exist? Its wording is very simple, and thus maybe doesn't flow seamlessly with the harder sentences that follow, but I think the sentence in question is helpful in introducing the paragraph. It's intended to briefly touch on two points: 1) homologous recombination varies notably among groups of organisms (e.g., among eukaryotes, bacteria and virues) and cells types within the same organism (e.g. between most somatic cells in mitosis and sex cells in meiosis); and 2) even given that diversity, there are high-level features shared between the several variations of HR. Perhaps this could be conveyed better; I am open to suggestions. Emw (talk) 01:37, 25 June 2010 (UTC) You were able to explain quite clearly to me what two points you wanted to make in the article. Finding a good replacement sentence is as easy as mashing up what you just said! How about something along the lines of "Although homologous recombination varies widely among different organisms and cell types, most forms of it involve the same basic steps"? --Cryptic C62 · Talk 01:39, 28 June 2010 (UTC) Much better! I've replaced my version of the sentence with yours. Emw (talk) 02:36, 28 June 2010 (UTC) "the version of homologous recombination" I would advise against the use of "version" here. Most nerds will be familiar with the meaning of "version" as it relates to computer science, which is not relevant here. I suggest dropping "the version of" altogether, as the sentence functions correctly without it. I would do this myself, but I noticed one other instance of "version" in this article, which led me to believe that it may be a piece of genetics jargon with which I am as yet unfamiliar, though I doubt this is the case. Using "version" emphasizes that HR is not a monolithic mechanism, but has notable variations -- as was indicated in the first sentence of the paragraph. I can't envision readers being confused by its usage,and don't think its more frequent use in software makes it irrelevant or somehow inappropriate when applied to biology. Nevertheless, I would be interested to hear your thoughts on a better synonym. Emw (talk) 01:37, 25 June 2010 (UTC) How about "form" or "variation"? --Cryptic C62 · Talk 01:39, 28 June 2010 (UTC) I didn't see any significant issue with 'version', but I've changed the word to 'type'. 'Form' isn't the most precise word, and 'variation of homologous recombination' is a mouthful of multisyllabism. Emw (talk) 02:36, 28 June 2010 (UTC) "In cells divide that divide mitosis" I'm no expert on cellular biology, but shouldn't there be a "through" or "by" between "divide" and "mitosis"? Fixed. Emw (talk) 02:36, 28 June 2010 (UTC) "1,000–2,000 base pair regions of chromosomes that have high rates of recombination." Multiple-word adjectives should be hyphenated, so technically speaking, this should read "1,000–2,000-base-pair regions of chromosomes that have high rates of recombination." Yuck! This highlights the underlying issue that using a number as part of an adjective is awkward and confusing. I am also not sure whether it is the region or the chromosome that has a high rate of recombination. If you can clarify this for me, I would be happy to try to find a wording that solves both problems. Colin also noted in his comments below. I thought I fixed it, but apparently I didn't save the edit or somehow overwrote it. I think this is now fixed. Emw (talk) 02:36, 28 June 2010 (UTC) Perhaps I'm missing something, but I find myself wondering: Why does the second paragraph of Timing within the cell cycle focus on yeast? Although I don't emphasize it much elsewhere, I've focused on yeast throughout most of the 'In eukaryotes' section. This is because our understanding of HR in eukaryotes is best for them. This is typically the way HR mechanisms are presented in textbooks, which is a reason I haven't considered it necessary to delve into differences in HR within eukaryotes. Emw (talk) 06:43, 1 July 2010 (UTC) As an astrophysics nerd, I was immediately confused by the use of the word "model" to describe the different pathways. Is this a term that is actually used in the cellbio literature, or was it a term that you introduced? If the second is true (and perhaps even if the first is true), I would prefer to use a different word. In many sciences, "model" is used to refer to a simplified explanation of a phenomenon that is not fully understand. The existence of multiple models for a single phenomenon usually means that neither model has been fully accepted or refuted. This is clearly not the case for homologous recombination, so perhaps the potential confusion can be avoided by simply using "pathway" instead. "Model" is used in molecular biology literature and in reference to different types of homologous recombination. In reality, none of the pathways of homologous recombination is "fully understood". We know a good amount about pathways' mechanistic details, and probably have a lot of the central features nailed down, but these have been quite active areas of research for the last 50 years and remain such today. There are multiple models for homologous recombination in, say, DNA repair that are not universally accepted nor fully understood. I've sought to convey these ideas with a degree of qualification similar to that found in cell biology textbooks. Emw (talk) 06:43, 1 July 2010 (UTC) "This cell-cycle based control of homologous recombination and NHEJ varies widely between species" The word "control" implies that there is some other mechanism determining which of the two should occur. I think it would be better to use a word like "distribution". Also, "cell-cycle based" should be hyphenated to "cell-cycle–based", but it would probably be better to avoid this awkward construction altogether. How about "This distribution of homologous recombination and NHEJ throughout the cell cycle varies widely between species"? The distribution isn't quite the thing that varies, it's the regulatory mechanisms. For example, different proteins get activated and deactivated, and this regulates the level of HR and NHEJ (and, in HR, the type) in different ways. Given that "cell-cycle based control" is referring more to the cell-cycle-dependent pathways that regulate HR and NHEJ than to the distribution of HR and NHEJ in the cell cycle, how (or would) your opinion change? Emw (talk) 06:43, 1 July 2010 (UTC) It is not clear upon first reading sentence refers to the regulatory mechanisms rather than the distribution throughout the cell cycle. I think the problem is the use of the word "this", implying that a previously mentioned topic would be the focus of the sentence, which is not the case since the previous paragraph was all about the distribution throughout the cell cycle. How about "The mechanisms which regulate homologous recombination and NHEJ throughout the cell cycle vary widely between species." ? --Cryptic C62 · Talk 13:59, 2 July 2010 (UTC) Excellent; so changed. Emw (talk) 16:35, 2 July 2010 (UTC) "the MRX complex recruits the Sae2 protein." Is "recruit" a cellbio jargon word? If not, I suggest replacing it with something more encyclopedic and less anthropomorphic. It's a term widely used in cell biology, yes. Emw (talk) 16:35, 2 July 2010 (UTC) "The two proteins then trim back" Which two proteins? I see Sae2, but is MRN/MRX the other one? MRN is comprised of three proteins, so the grand total should be four. Protein complexes like MRX (and RecBCD and RuvABC, covered later) are typically referred to as singular proteins. Emw (talk) 16:47, 2 July 2010 (UTC) "With the help of several mediator proteins," What is a mediator protein? They're simply proteins which mediate the process. I've changed the phrase to seem less jargon-like. Emw (talk) 16:47, 2 July 2010 (UTC) "Upon finding such a sequence, in a process called strand invasion, the single-stranded nucleoprotein filament moves into (invades) a similar or identical recipient DNA duplex." As this is currently written, it implies that the process referred to as "strand invasion" is the finding of the sequence rather than the invasion itself. I suggest moving this note to the end of the sentence: "Upon finding such a sequence, the single-stranded nucleoprotein filament moves into a similar or identical recipient DNA duplex in a process called strand invasion." Strand invasion really encompasses both. It includes the initial binding of the donor strand into the recipient duplex and the homology search. This topic needs slightly more development than is appropriate in this article. I will make a new article on it tonight and note it here upon completion. Emw (talk) 16:35, 2 July 2010 (UTC) One of the textbooks I've got handy suggests the opposition of what I just said. Strand invasion is distinct from the homology search, and comes after it. I've changed the wording of the sentence in question to closely match your wording. Emw (talk) 06:54, 3 July 2010 (UTC) FYI: with regard to a new article on 'strand invasion', it seems that it would be better to overhaul the article on Synapsis, the context in which strand invasion occurs during homologous recombination. That article on synapsis seems to conflate a lot of topics relevant to HR, and in my opinion will require significant rework to become adequate (this is before a section on 'strand invasion' is added). Emw (talk) 14:16, 4 July 2010 (UTC) If you decide to work on Synapsis, be sure to leave a note on my talk page if you'd like me to read through it. Also, you mentioned above that you changed the wording of the highlighted sentence, but I think that may have just been a dream. The sentence is unchanged. --Cryptic C62 · Talk 02:35, 6 July 2010 (UTC) Ha! Apparently I changed a similar sentence in the 'In bacteria' section. The sentence in question from the 'Models' section is now amended along the lines of your suggestion. Emw (talk) 06:07, 8 July 2010 (UTC) "While it was thought to result in either crossover or non-crossover, several studies have suggested the DSBR pathway results most commonly in crossover recombination." I don't think that it's necessary to have historical information in any section other than the history section, especially since this particular finding doesn't even definitively rule out non-crossover. The only relevant piece of information here is that the DSBR pathway favors crossover, but this fact can very easily be made clear in the next sentence. I suggest removing this sentence altogether. I've reworded the sentence to state the fact without the historical context. That the DSBR pathway can sometimes result in non-crossover is also relevant; removing the sentence would omit this notable detail. Emw (talk) 06:07, 8 July 2010 (UTC) "the DSBR pathway is a likely model of how homologous recombination occurs during meiosis" This is an odd phrasing. It is not grammatically accurate to describe the model as being "likely" or even "highly probable". I'm not even sure what exactly this is trying to convey. Perhaps "it is highly likely that the DSBR pathway is the correct model of how homologous recombination occurs during meiosis." or "it is highly likely that the DSBR model occurs during meiosis"? How is "likely model" grammatically inaccurate? The phrase is commonly used in scientific literature and retains its intuitive meaning across fields. To me, the alternative wordings proposed above seem more awkward and/or more likely to befuddle readers than the current wording. Emw (talk) 06:07, 8 July 2010 (UTC) "(along the black arrowheads at both Holliday junctions in the accompanying figure)" Two problems with this. First, this paragraph is roughly equidistant from two pictures, making it unclear which one is being referred to. Check out the way the images are named in Distributed element filter for a possible solution. Second, assuming the reader finds the correct image, there are lots of black arrowheads in the figure. Perhaps it can be recolored? Good points. I've numbered each figure in the article, and changed the color of the arrowheads in question to purple. Emw (talk) 06:07, 8 July 2010 (UTC) "Alternatively, chromosomal crossover..." An alternative often has the connotation of being less commonly used than the first option, which makes this somewhat contradictory with the crossover/non-crossover bit in the previous paragraph. I suggest switching the order of the crossover/non-crossover information in this paragraph to make it match. Another good point. Done. Emw (talk) 06:07, 8 July 2010 (UTC) "The newly synthesized 3' end of the invading strand is then able to anneal to the other original 3' overhang" The series of adjectives "other original" is confusing here. "other original" implies that there was an original that was previously mentioned in the sentence, but the only other 3' end was synthesized. It seems that, unless I'm misinterpreting something, "other" should be removed. As depicted in the second step in Figure 4, the process of resection results in two 3' overhangs. If we're looking to pare back wording (which I don't think is inappropriate here), then 'original' is somewhat extraneous. I've removed the word. Emw (talk) 02:39, 9 July 2010 (UTC) "The SSA pathway is notable in that it does not require a separate similar or identical molecule of DNA," If it were not notable, it would not be mentioned on Wikipedia, would it? I think a better word would be "unique". Sure, so changed. Emw (talk) 02:56, 14 July 2010 (UTC) "after two strands of the same DNA duplex are cut back" I'm not sure why this is italicized. It's not a new jargon phrase and it doesn't need to be overemphasized since this was already made clear earlier in the paragraph. Am I missing something? Changed. Emw (talk) 02:56, 14 July 2010 (UTC) "the RPA protein coats the 3' overhangs being produced to prevent them from sticking to themselves" I expected "coats" to be a transitive verb here, so I was confused until I realized that the RPA protein is the actual coating material, not the thing that's providing the coating material. Perhaps "the 3' overhangs are coated with the RPA protein to prevent them from sticking to themselves" would be clearer. Also, RPA is a disambiguation page. Did you mean Replication protein A? Isn't "coats" being used as a transitive verb in my wording above, and your suggested wording a passive use of "coats" and thus intransitive? In any case, I've disambiguated the RPA wikilink and gone with something closer to your suggested wording: the single-stranded 3' overhangs being produced are coated with the RPA protein, which prevents the 3' overhangs from sticking to themselves. Emw (talk) 02:56, 14 July 2010 (UTC) "telomeres typically shorten with each round of mitosis" Unless "round" is a jargon word with which I'm not familiar, I suggest replacing it with a more encyclopedic alternative. Perhaps "cycle" would be more appropriate. Done. Emw (talk) 23:20, 17 July 2010 (UTC) "in which those two intercrossed molecules of DNA are cut separate and restored to their normal double-stranded state." Odd wording. Unless I've missed the intended meaning, I think "separated" would be a better choice instead of "cut separate", or perhaps "cut apart" if you wish to emphasize the cutting. Done. Emw (talk) 23:20, 17 July 2010 (UTC) "In this pathway, a three-part enzyme complex called RecBCD initiates recombination by binding to a blunt or nearly blunt end of a break in double-strand DNA." What does "blunt" mean in this context? I was unaware that DNA could be sharp. Also, what does "double-strand DNA" mean? I thought all DNA was double-stranded. Perhaps "double-strand break in DNA" was the intended wording. Not all DNA is double-stranded. I use the phrase 'double-strand' because RecBCD cuts back regions of double-stranded DNA to become single-stranded. I've also wikilinked "blunt or nearly blunt" to a relevant section of DNA end; explaining it in context would be make for cumbersome reading. Emw (talk) 23:20, 17 July 2010 (UTC) "After RecBCD binds with DNA, the RecB and RecD subunits begin unzipping the DNA duplex through helicase activity driven by energy provided from ATP hydrolysis." I think the phrase "driven by energy provided from ATP hydrolysis." From the perspective of someone who is not very familiar with cellular biology and just wants an overview of homologous recombination, this introduces an unnecessary technical detail that does not aid in the overall understanding. From the perspective of an expert on cellular biology, this is a trivial detail which would probably be better off in the RecBCD article. Imagine if the article on I-beams had a sentence that read "I-beams are attached using stainless steel bolts which include chromium from South Africa." :P I've removed the phrase. Emw (talk) 23:20, 17 July 2010 (UTC) "with RecB cutting the 3' strand more frequently than RecD cuts the 5' strand." Why does this matter? I suggest either adding an explanation of the significance of this differential or dropping it entirely. Good point. I've removed the detail. Emw (talk) "Splice products are crossover products, in which there is a reassortment of genetic material that flanks the site of recombination." Odd word choice unless you're a military history expert. Perhaps "that flanks" could simply be replaced with "around"? Changed. Emw (talk) 11:54, 23 July 2010 (UTC) "Studies in several bacteria have established that there is a log-linear decrease in recombination frequency with increasing sequence divergence between host and recipient DNA." This is a monster of a sentence in terms of technical word abuse. I'm not even sure I fully understand what it says, so here's my best guess: The more genetically distinct two organisms are, the less likely it is that horizontal gene transfer will successfully occur. Yeah? Right. The sentence immediately before the one in question gives context, and says effectively the same thing as your synopsis. The purpose of the sentence in question is to give more granular detail, which in itself is a summary of the Discussion section of three journal articles. Again, a graph here would be helpful in indicating the real bit of information here: a log-linear decrease. Emw (talk) 11:54, 23 July 2010 (UTC)

Unresolved issues

• "SDSA is completed with the removal of 3' flaps" What does "flap" refer to in this context? I would be satisfied with a wikilink, but I didn't see any helpful articles at flap.

• I don't think 3' flaps are notable enough to warrant a separate article. I've added some explanation. (If the reader understandably struggles to visualize this concept, 3' flaps are shown in Step 4 of the animation in Figure 5.) Emw (talk) 02:39, 9 July 2010 (UTC)

• Hrm, the animation doesn't seem to be working. Are you certain that you uploaded the file correctly? --Cryptic C62 · Talk 20:06, 12 July 2010 (UTC)

• Yes, the file was uploaded correctly. MediaWiki's support for SVG isn't good, and its support for animated SVG is worse. The user must click once to access to the 'File page' -- which has a PNG rendering of the static SVG -- then click that rendering to access the underlying SVG file. That SVG file only renders as an animation in browsers that support animated SVG, or SMIL; this is indicated in the caption of Figure 5. The static PNG rendering of the animated SVG is a tolerable substitute for browsers that don't support the format -- Firefox and IE. For browsers that do support animated SVG -- Chrome, Opera and Safari -- using the format is a substantial aid in visualization. Firefox 4 beta natively supports animated SVG, and upon its public release in Q4 2010 will significantly increase the share of users with easy access to this animation. I believe the current IE9 beta also supports animated SVG, although not flawlessly. Emw (talk) 02:56, 14 July 2010 (UTC)

• More than 80% use Internet Explorer or Firefox, meaning the vast majority of our readers won't be able to see the animation. Perhaps Animated PNG or Animated GIF would be a better choice in terms of WP:ACCESSIBILITY. --Cryptic C62 · Talk 16:36, 15 July 2010 (UTC)

• I don't think an animated PNG and or GIF would be an adequate substitute for the SVG animation in question. The length of the animation would make the file size of an animated PNG/GIF version much larger than the current SVG version. Also, infinite loops of animated PNG/GIFs can be quite distracting. While the animation won't be accessible to everyone, and this is unfortunate, I don't see anything in WP:ACCESSIBILITY particularly relevant to this issue. While about 80% of users don't have native support for animated SVG, over 50% don't use browsers with native support for Ogg Theora, MediaWiki's only supported video format. If I were to change the format (or make new animations), I would consider Ogg Theora if not SVG. Because the animation is informative even as a still frame, I think the use of animated SVG can be considered a progressive enhancement for users with support. Emw (talk) 23:20, 17 July 2010 (UTC)

• I strongly disagree that the animation is informative as a still frame. As someone who knows very little about cell bio and as someone who has never seen the animation and can't imagine what it might look like, the still frame provides no new information of any kind. Why not simply employ a step-by-step diagram like in Figure 7? --Cryptic C62 · Talk 12:12, 20 July 2010 (UTC)

• The still frame has a list of steps which reinforce the pathway's description in the text, and also shows the positioning of repeat elements in DNA. Given that, I think the still frame is somewhat informative, although not as informative as the animation, thus making the animation a progressive enhancement. If I have time, I may create an animated SVG which shows a more comprehensive still-frame after being processed by MediaWiki. Emw (talk) 11:54, 23 July 2010 (UTC)

• "The pathways are also similar in their phases of branch migration, in which the Holliday junction slides in one direction," I'm not sure what the intended meaning of "slides in one direction" should be. Is it ever possible for an object to slide in multiple directions? :P

• Branch migration can be toward the 3' end or the 5' end, so the phrase 'in one direction' is not extraneous. In my opinion it is also not useless detail for the lay person; it helps somewhat to visualize the process. A diagram here would be especially helpful. Emw (talk) 11:54, 23 July 2010 (UTC)

• Perhaps the 3'/5' bit can be stated explicitly: "The pathways are also similar in their phases of branch migration, in which the Holliday junction slides towards the 3 end or the 5' end" --Cryptic C62 · Talk 14:17, 27 July 2010 (UTC)

• "The RecBCD enzyme promotes recombination after DNA" What does "promotes" mean in this context?
• "There is controversy over whether homologous recombination occurs in negative-sense ssRNA viruses like influenza" I don't think that "controversy" is the best word here. Perhaps "There is not yet consensus..." would work better.
• "For example, if the genomes of two viruses with different disadvantageous mutations undergo recombination, then they may be able to regenerate a fully functional genome" This is somewhat confusing because there is a contrast between "disadvantageous" and "fully functional", which are not really opposites. Having a disadvantageous mutation doesn't imply that the genome is dysfunctional. Not sure how you would want to address this.
• Caption: "Protein domains in homologous recombination-related proteins are conserved across the three main groups of life: archaea, bacteria and eukaryotes." I assume the list was ordered alphabetically or chronologically, but I think it would make more sense to list them in the same order as they appear in the diagram: bacteria, eukaryotes, archaea. Alternatively, the diagram could be rearranged to match the current list order.

I will add comments here as I go through the article. As you address issues, please respond beneath the individual concerns above so that I know which are done and which require further discussion. Thanks! --Cryptic C62 · Talk 02:26, 24 June 2010 (UTC)

Thank you for the continued input! What are your thoughts on moving these comments into the FAC review? I see two benefits: 1) it would make it easier in the future to find the reviews for this FAC, and 2) it would inform potential FAC reviewers and the FAC delegates that reviews are still ongoing. Emw (talk) 06:07, 8 July 2010 (UTC)

I used to leave all of my comments on the FAC page, but doing so created two problems which were easily solved by leaving them on the talk page instead: the first is that leaving so many comments can clutter up the FAC page and also bog down the main listing at WP:FAC. The second is that if the FAC closes (successful or not) before I finish my review, I can continue working with the author without having to edit an archived page. The other reason that I personally prefer leaving comments on talk pages is that it opens up the discussion to other interested editors who may not be familiar with the FAC process. As for your concern about keeping the FAC delegates informed, don't worry about it. User:Karanacs and I have been through this song and dance many times before. As long as it's clear that the author (you) is committed to addressing my nitpicks (which is obviously the case here), she won't close the FAC as unsuccessful just because I go through articles like a snail through molasses. --Cryptic C62 · Talk 18:29, 8 July 2010 (UTC)

Review discontinued due to inactivity. If anyone is interested in continuing, feel free to leave a message on my talk page. --Cryptic C62 · Talk 15:00, 23 August 2010 (UTC)

Comments by Colin

The lead generally does a very good job. I can't comment on whether it is comprehensive but it is fairly accessible to a lay reader. However, lead terms that may not be understood are: homologous, eukaryotes, protists, eukaryotic, conserved. If you can make those accessible, you stand a chance of keeping the reader beyond the lead!

• I've given an example of eukaryotes, and briefly defined protists. I think readers will make the connection between 'eukaryote' and 'eukaryotic'. I also think 'conserved' is close enough to its general meaning to be understood at a basic level by lay readers. In the lead caption, I've changed 'homologous' to 'similar but not identical'. Emw (talk) 00:31, 27 June 2010 (UTC)

History:

Once the reader gets past the lead, the first sentence he gets in the history is "Following the discoveries made by Gregor Mendel, it was shown that genes are often linked and do not segregate randomly." This is a bit off putting because it assumes the reader knows what "discoveries" Mendel made. The average reader will connect Mendel with genetics but this is a very advanced genetic topic so will wonder if there's some specific discovery they should know about. I think you need to explain "linked" and "segregate". The latter could also be linked to the appropriate bit in Mendelian inheritance perhaps.

• Good point. I've revised that paragraph in light of your comments. Emw (talk) 00:31, 27 June 2010 (UTC)

The sentence "Thomas Hunt Morgan introduced the term "crossing over"" doesn't explain what he introduced the term for. It gives an explanation later in the sentence but says this was "shown later" which begs the question why he introduced the term if he didn't know what it meant.

• I've addressed this point in my revision. Emw (talk) 00:31, 27 June 2010 (UTC)

This is such a complex subject that you might need to re-explain jargon that is already explained in the lead. So it probably does no harm to explain meiosis and you haven't yet explained mitosis.

• Meiosis has now been explained, and I've added some context to mitosis. Emw (talk) 00:31, 27 June 2010 (UTC)

Hans Winkler's "gene conversion" term is not defined. I'm beginning to wonder if the History can only be understood once you've read the article. The "Holliday junctions", "DSBR pathway" and "SDSA pathways" aspects won't really mean anything to the reader at this stage, so they can't really grasp why these discoveries are relevant.

• I've removed the reference to Winkler, and added context on what Holliday junctions are and thus why Holliday's model matters. While the reader likely won't know much about the DSBR and SDSA pathways, I give them some context and wikilink the specific sections. This also is a bridge that leads the reader into the next section which discusses the pathways in more detail. Emw (talk) 00:31, 27 June 2010 (UTC)

I think the gene targeting sentence "In recognition...2007 Nobel Prize" belongs in this section, not the gene targeting section. I wonder also if some aspects of the cancer therapy is notable enough to appear in the history.

• I'd like to prevent the 'History and discovery' section from becoming another lead. Gene targeting and cancer therapy are applications and aren't particularly relevant in terms of historical context of the discovery of homologous recombination. Emw (talk) 00:31, 27 June 2010 (UTC)

In eukaroytes:

You need to define "eukaroytes". My comments on explaining mitosis/meiosis may apply here if the History section is moved. Define "somatic cells".

• I prefer not to move the History section. Although it's been given more context in the lead, I've also now defined eukaryotes by listing example organisms here. (I don't think it's necessary to redefine what a protist is in that list.) In my rework of the History section I've also defined 'somatic cells' by example. Emw (talk) 00:31, 27 June 2010 (UTC)

The sentence "Chromosomal crossover begins when the Spo11 protein makes a..." is written with the assumption that the reader knows the Spo11 protien and is best friends with its brother. I'm guessing at this stage that I don't need to know much about Spo11 other than what it does here. You can help me feel less ignorant my saying "begins when a protein called Spo11 makes a...". I'm guessing that "programmed" means "deliberate"?

• Changed phrase to "...begins when a protein called Spo11 makes a targeted...". Emw (talk) 00:31, 27 June 2010 (UTC)

"1,000-2,000 base pair regions of chromosomes" I know what "base pairs" are (well, vaguely) but the general reader wont. They might not appreciate that this appears to be a description of the size of the regions. Should it be "in chromosomes"?

• I've now wikilinked base pair and rearranged the phrase to indicate it's referring to a description of length. Emw (talk) 00:31, 27 June 2010 (UTC)

"by the phase of cell cycle" Ok I'm beginning to get lost. Can you give me a brief introduction to the "cell cycle" and the phases. The diagram on the right needs the key from Cell cycle otherwise it isn't telling me anything.

• I've added some context to indicate what the cell cycle is. Also, in the diagram caption, I've added some material to help readers understand what the S, G2 and M phases are. I think the expanded caption, which is more or less duplicated in the section's body, along with the new brief context on what the cell cycle is, now give the lay reader enough background to get a fair handle of what's going on. I think an expanded introduction to the cell cycle could bring the section off-topic. Emw (talk) 13:32, 27 June 2010 (UTC)

"Cyclin-dependent kinases (CDKs), which modify" I don't know what kinases are never mind Cyclin-dependent ones. Looking up WP, I see they are enzymes. Could we say something like "Homologous recombination in eukaryotes is regulated by cyclin-dependent kinases (CDKs), enzymes that modify the activity of other proteins by adding phosphate groups to them (known as phosphorylation)."

• Everything in your suggestion seems to be there in the previous wording, except explicit mentioning that CDKs are enzymes. That is now noted. Emw (talk)

I don't know what "endonuclease activity" is. Or what the MRX complex is.

• Is "endonuclease activity" not indicated sufficiently by the context? It means that Sae2 cuts DNA. Technically, that Sae2 cuts within the DNA, but I think noting this detail may bog readers down more than inform them. I've moved the brief definition of the MRX complex up a section. Emw (talk) 00:31, 27 June 2010 (UTC)

"a homolog of the bacterial RecQ helicase discussed above" The RecQ helicase is discussed below. So I can't follow this and I don't know what a helicase is.

• Helicase is defined in the next sentence. I've removed the bit about homology to the RecQ helicase. Emw (talk) 00:31, 27 June 2010 (UTC)

Colin°^Talk 20:37, 25 June 2010 (UTC)

dead link

This article has a dead link (ref 2)[1] MacDaid (talk) 18:28, 26 June 2010 (UTC)

Thanks, fixed. Emw (talk) 00:55, 27 June 2010 (UTC)

File:RecBCD recomb model.tif Nominated for speedy Deletion

An image used in this article, File:RecBCD recomb model.tif, has been nominated for speedy deletion at Wikimedia Commons for the following reason: Copyright violations What should I do? Don't panic; deletions can take a little longer at Commons than they do on Wikipedia. This gives you an opportunity to contest the deletion (although please review Commons guidelines before doing so). The best way to contest this form of deletion is by posting on the image talk page. If the image is non-free then you may need to upload it to Wikipedia (Commons does not allow fair use) If the image isn't freely licensed and there is no fair use rationale then it cannot be uploaded or used. If the image has already been deleted you may want to try Commons Undeletion Request To take part in any discussion, or to review a more detailed deletion rationale please visit the relevant image page (File:RecBCD recomb model.tif) This is Bot placed notification, another user has nominated/tagged the image --CommonsNotificationBot (talk) 11:49, 27 March 2012 (UTC)

I nominated this image for deletion because it seems to have been a screenshot of Figure 1B from Genes Dev. 2007 December 15; 21(24): 3296–3307. The image is Copyright © 2007, Cold Spring Harbor Laboratory Press. Source: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2113030/figure/F1/. I've removed the figure (Figure 7A) and its caption from this article. This shouldn't affect the article much, since the figure was largely redundant with Figure 7B (now Figure 7). Emw (talk) 16:15, 27 March 2012 (UTC)

LESS COMPLEMENT: сanon structura of cross-siments of DNA

TTAACAGGATACCCGATCTAGCCGCAAGCATACTTGACC

TTAACAGCATACTTGACC

TTAACAGGATACCCGATCTAGCCGCAAGCATACTTGACCTAGCCGCAAGCATACTTGACC

TTAACAGGATACCCGATCTAGCCGCAAGGATACTTGACCTAGCCGCAAGCATACTTGACC

and TTAACAGGATACCCGATCTAGCCGCAAGCATACCCGATCTAGCCGCAAGCATACTTGACC

--WITH THISE is quazi COMPLEMENT---

AATTGTCCTATGGGCTAGATCGGCGTTCCTATGGGCTAGATCGGCGTTCGTATGAACTGG

(of Book Singer&Berg Genes and Genomes) total line of the programm searh =20.THE END for thise Quston, ALL comments dont not living!!тишина!

difficulty with </ref>

I have tried multiple times to insert a reference correctly at the end of the section on viruses. My reference works perfectly in my sandbox. I have tried using Wikipedia template filling to make sure I did it correctly, but I get the same error each time, Cite error: A (see the help page).Chaya5260 (talk) 23:39, 8 December 2013 (UTC)

Proposed split out of Effects of dysfunction section to Homologous recombination deficiency

This is a big topic now in ovarian cancer, and as a target of PARP inhibitor drugs. - Rod57 (talk) 13:10, 30 December 2016 (UTC)

@Rod57: No response for a few years and the section is small and fits here. I would suggest that if you are interested and there is enough notability then you can create the article yourself. AIRcorn (talk) 03:46, 31 March 2018 (UTC)

Recombination: biased or not fragmentation segments/fragments

One big issue is if the fragmentation places exhibit some bias (not necessarily absolute but regional), and that opens the path to more questions (if epigenetic changes have an impact on the patterns of recombinant fragmentation).

It doesn't have to happen all the time and at exact places; even small biases play a huge role in millions of years of evolution.

We need more data. — Preceding unsigned comment added by 2A02:587:4104:99BE:B1CD:5E5B:5D0B:33E4 (talk) 01:37, 22 October 2020 (UTC)

Reference links to WHO Bulletin: 1 July 2021

Ref 102 (Viral transmission and evolution dynamics of SARS-CoV-2 in shipboard quarantine) was the correct reference for what was being claimed, with correct name and authorship, but all links went to the subsequent paper from the same journal (Specifically a paper about use of an alcohol screening tool in Russia)

While it was an easy fix, other uses of the same source on different pages, probably should be checked, to see if this is a systemic issue due to the journal readdressing or incorrectly addressing their DOIs initially, or if this is a one time issue. — Preceding unsigned comment added by PewterPenguin (talk • contribs) 04:41, 27 December 2021 (UTC)

Update:

https://en.wikipedia.org/wiki/Coronavirus_3%E2%80%B2_stem-loop_II-like_motif_(s2m) Fixed

https://en.wikipedia.org/wiki/COVID-19_pandemic_on_Diamond_Princess Fixed

https://en.wikipedia.org/wiki/Diamond_Princess_(ship) Fixed

https://zh.wikipedia.org/wiki/%E9%91%BD%E7%9F%B3%E5%85%AC%E4%B8%BB%E8%99%9F Fixed

All found to have the exact same issue, suggesting systemic issue. WHO Bulletins should probably be watched in the future for changes in links. — Preceding unsigned comment added by PewterPenguin (talk • contribs) 04:51, 27 December 2021 (UTC)